[ad_1]
Ethical approval
The ethical clearance was obtained from the Biosafety, Biosecurity & Ethical Committee at the Jahangirnagar University. The informed consent was taken from the participants before taking the survey.
Method guidelines
The authors confirm that all the methods were performed in accordance with the relevant guidelines and regulations. All methods were performed in accordance with the our previously published articles3,5,7,8. For bacterial culture and antibiotic sensitivity test, guidelines from ATCC (https://www.atcc.org/) and CLSI (https://clsi.org/) were followed, respectively.
Study population and fecal specimens
A total of 404 fecal specimens were collected from patients with diarrheal diseases from 3 clinics of two different localities (Savar and Tangail) in Bangladesh through January 2019 to December 2021. Samples were collected from Enam Medical College (135 of 404) and Dip Clinics (125 of 404) in Savar and Kumuduni Women’s Medical College (144 of 404) in Tangail. Convenience sampling method was used to enroll the participants. Epidemiological and demographic data were collected from children aged below 18 years with acute gastroenteritis. The participants of this study were divided into seven age groups including the range in months, 1–3, 4–11, 12–23, 24–35, 36–47, 48- 60 and > 60 (Table 1). Clinical symptoms data of children were analyzed. Informed consent was obtained from the parents of patients. Inclusion criteria to take samples were patients age below 18 years, have symptoms of diarrhea according to WHO definition, reported in the clinic’s outpatients, inpatients or emergency department. Exclusion criteria were patients aged above 18 years, did not report of their diarrheal cases in these clinics during the study period, missing demographic data, and having other health complications. One fecal specimen was collected from every participant. After collection, the specimens were stored at − 20 °C. Transportation of the fecal specimens were conducted by maintaining − 20 °C temperature in ice box. All the specimens were stored at − 20 °C after being transported under maintaining proper conditions3. All methods were performed in accordance with the our previously published articles3,5,7,8.
Laboratory tests for V.cholerae, DEC, Salmonella spp., and Shigella spp
Colony characterization of bacterial pathogens were performed on specific selective agar media. MacConkey Agar, Thiosulphate-Citrate-Bile Salt Sucrose (TCBS) Agar, and Salmonella Shigella (SS) Agar media (HIMEDIA, India) were utilized aseptically to isolate and identify diarrheagenic E. coli (DEC), V.cholerae, Salmonella spp., and Shigella spp. Eosin Methylene Blue (EMB) Agar (HIMEDIA, India) for E.coli and Xylose Lysine Deoxycholate (XLD) Agar (HIMEDIA, India) for Salmonella spp. and Shigella spp. were used for further identification3,9.
Antibiotic susceptibility test of enteric bacterial pathogens
Antibiotic susceptibility test was performed by following the Kirby-Bauer Disk Diffusion Test and according to the CLSI guidelines3,29. Antibiotics of nine different groups were used, following the CLSI manual (Table 5). The susceptibility of the pathogens to each antibiotic was determined by measuring the zone diameter, which was further classified as resistance, intermediate, or susceptible according to the CLSI guidelines. E. coli ATCC 25922 strain was used concurrently as control to determine the validity of the test protocol.
Bacterial genome extraction and polymerase chain reaction
The bacterial genome was extracted by using the previously described boiled DNA method3,30. Further, genome of virus was isolated and purified (Supplementary material). The isolated bacteria were identified by using polymerase chain reaction (PCR). The following sequences of 16S rRNA primers (F- AGT TTG ATC CTG GCT CAG and R- ACC TTG TTA CGA CTT) were used for PCR reaction3. The PCR reaction mixture contained 12.5 µl of 2X master mix (GoTaq Green Master Mix, Promega, USA), 1 µl of forward (F) primer, 1 µl of reverse (R) primer, 6.5 µl of nuclease-free water, and 4 µl of template DNA (Eppendorf, Germany). The final volume of reaction mixture was 25 µl. The PCR reaction was conducted in a thermal cycler (2720 Thermal Cycler, Applied Biosystems, USA). The PCR reaction was performed at 94 °C for 5 min, followed by 35 cycles at 94 °C for 30 s, 53 °C for 30 s, and 72 °C for 60 s3. The details of the PCR conditions for the detection of antimicrobial resistance genes are provided in the supplementary material.
PCR reaction to detect antimicrobial resistance genes
Primer pair, F- CATCTACCACTTCATAGGCAGC and R- CAGCTTAACTCACCAAGGAC were used for the amplification of sxt (242 base pairs) resistance gene. The PCR of sxt was conducted at 94 °C for 2 min 1 cycle, followed by 35 cycles of 94 °C for 1 min, 60.5 °C for 1 min, 72 °C for 1 min and a final extension at 72 °C for 10 min. For the amplification of qnrA (492 base pairs) primer pairs, F- GGATGCCAGTTTCGAGGA and R- TGCCAGGCACAGATCTTG were used in a thermal cycle at 94 °C for 5 min followed by 35 cycles at 94 °C for 1 min, 59 °C for 1 min, 72 °C for 1 min and final extension at 72 °C for 10 min. Primer pairs F-GATCGTGAAAGCCAGAAAGG and R-ACGATGCCTGGTAGTTGTCC were used for the amplification of qnrB (469 base pairs) resistance gene (Table 6). The PCR was conducted at 94 °C for 2 min followed by 35 cycles at 95 °C for 45 s, 53 °C for 45 s, 72 °C for 1 min and final extension at 72 °C for 5 min. For blaTEM (750) resistance gene primers, F- TCGGGGAAATGTGCGCG and R-TGCTTAATCAGTGAGGACCC were used (Table 6). PCR was done at 94 °C for 7 min followed by 30 cycles at 94 °C for 30 s, 53 °C for 30 s, 72 °C for 30 s and final extension at 72 °C for 5 min. Primer pair, F- GCTCGGTCAGTCCGTTTGTTCTTG and R- GGATGAATGCGGTGCGGTCTT were used for mcr-1, colistin resistance genes at 93 °C for 3 min followed by 35 cycles at 93 °C for 15 s, 57 °C for 30 s, 68 °C for 70 s followed by final extension at 72 °C for 5 min. For molecular detection of tet genes, previously published articles were followed (Table 6). All the PCR products were kept at 4 °C.
Viral genome extraction
Total viral genome was extracted by using the Promega SVA total genome kit according to the manufacturer’s protocols (Promega, Madison, USA)5,7,8. Reverse transcriptase polymerase chain reaction method was performed to detect rotavirus and norovirus and polymerase chain reaction to detect adenovirus and human bocavirus. Molecular sequencing method was applied to confirm genotypic characteristics of viruses5,7,8.
Agarose gel electrophoresis
The amplicons of the PCR were electrophoresed by using 1.5% agarose gel. Horizontal gel electrophoresis was run for 30 min3. Ladder DNA of 1 kilo base pair was used and specific amplicons were visualized by using the UV spectrophotometer (SPECORD-205, Analytik-Jena, Germany).
Nucleotide sequence analysis
The nucleotide sequences of PCR amplicons (DNA) positive for E. coli, V. cholerae, Salmonella spp. and Shigella spp. were determined with the Big-Dye terminator cycle sequencing kit and an ABI Prism 310 Genetic Analyzer (Applied Biosystems Inc. Foster City, CA). The sequences were analyzed by using Chromas 2.6.5 (Technelysium, Helensvale, Australia). Sequence homology was confirmed by using the BLASTn (https://blast.ncbi.nlm.nih.gov/Blast.cgi) program. Multiple sequence alignment (MSA) was performed in the BioEdit 7.2.6 software using the ClustalW Multiple Alignment algorithm3,31.
Phylogenetic analysis
Phylogenetic relationship and molecular evolutionary analysis of qnrB, mcr-1, blaTEM and tet genes with the reference sequences were conducted by using MEGA 10.0 software32. Phylogenetic trees were built by using the Maximum Composite Likelihood (MCL) method3,32. Reference sequences were retrieved from the GenBank Database (https://www.ncbi.nlm.nih.gov/nucleotide/). The datasets generated and/or analyzed during the current study are available in the NCBI repository. The following reference strains were used for phylogenetic analysis of qnrB gene: MF999219, CP059125, CP051692, CP031833, EU127476, CP096261, OM975894, CP088121, CP032204, CP054227, CP032204 and MN200703 (outgroup). Reference strains for blaTEM gene were: CP050932, CP048610, ON221405, ON221404, NG050233, AB700703, CP094365, CP095663, CP095655, CP095626, CP095618, KP853092, CP087666, CP095156, KT417856, KY739693 and KF268350 (outgroup). mcr-1 gene were: KY013597, OM069356, OM069355, OM038692, OM038691, CP102678, OL504740, CP101861, CP030156, CP101391, CP101366, CP100031, CP100017, CP101213, CP099722, CP081339, CP065023, CP091559, CP091557, MW421457, MW719568, CP090269, MW836072 and KF268350 (outgroup). tet genes: NG_048131, AJ514254, CP049298, CP043636, CP104212, CP089096, CP040909, KJ797592, CP103193, AY265739, CP043637, CP043637, and KF268350 (outgroup). The nucleotide sequences generated in this study were submitted in the GenBank, NCBI under the submission ID, 2664914, 2664908, 2664900, and 2664883 and accession number OQ297026-OQ297034.
Statistical analysis
We used percentage to present categorical variables and mean/ median for continuous variables. Inferential statistics (p value) was applied for the analysis. We calculated odds ratio (OR) of categorical variables by using two-tailed Chi-square or Fisher’s exact tests with 95% confidence intervals (CIs). For two-tailed tests p value < 0.05 were considered as significant. We performed data analysis by using Statistical Product and Service Solutions (SPSS v24.0) software (IBM, US).
|
Sources 2/ https://www.nature.com/articles/s41598-023-41174-6 The mention sources can contact us to remove/changing this article |
[ad_2]